Tuesday, March 10, 2020

Aflatoxins Essays

Aflatoxins Essays Aflatoxins Essay Aflatoxins Essay Drumhead Aflatoxins are extremely toxic fungal metabolites found in human and carnal nutrients. Aflatoxin B1 is the most carcinogenic and mutagenic metabolite nowadays in animate being, feedstuff and alterations to Aflatoxin M1 in milk. Aflatoxin M1 has a considerable hygienic hazard for human wellness. Previous researches have been shown different attacks for decontamination of this metabolite. Removal of Aflatoxin M1 by chemical, physical and biological methods has been studied. In old surveies, some species of Fungis and bacteriums have been demonstrated to degrade or adhere the Aflatoxin M1 in liquid media. In this research, two species of Lactic Acid Bacteria ( LAB ) are used. Lactobacillus delbrueckii subsp. Bulgaricus and Streptococcus thermophilus have the of import function in yoghurt production and agitation. In this survey, adhering activities of these two strains will be assessed in milk and yogurt and binding degrees of strains will be compared with each other. Besides, the degra ding ability in milk and yogurt will be considered and compared. Then the treatment will be made that which type of merchandise has been shown more binding ability and analyzing the chief factors and chief grounds that will be done for the achieved consequences. Description of scientific aim Mycotoxins are the secondary toxic metabolite of Fungis, produced in the terminal of logarithmic growing stage. Production of mycotoxins depends on handiness of sufficient and suited of indispensable foods for growing, suited environment such as the specific humidness, temperature, PH, and the presence of toxigenic molds. They affect on the undermentioned factors: growing rate in immature animate beings and babies, interfere in mechanism of organic structure, fondness on immunological system and cause reactivity ( Pier, 1981 ) . Higher degree of these factors leads to decease by damaging the kidney and liver ( Hayes, 1980 and Dvorackova, 1990 ) . Harmonizing to the Food and Agriculture Organization ( FAO ) ,25 % of the universe s harvest contaminated by mycotoxins ( Giessen, 1998 ) . Aflatoxins are one of the chief groups of mycotoxins. They have extremely toxic, mutagenic, carcinogenic, teratogenic and immunosuperssive effects on assorted carnal species and homo. They are produced by three strains of fungi Aspergillus flavus, A.parasiticus and A.nominus. Aflatoxin s best temperature for growing is between 12oc- 40oc ( Koehler et al. , 1985 ) . Four types of toxins have been found in these metabolites which are divided in two groups B ( B1, B2 ) and G ( G1, G2 ) . Aflatoxin B1 has the inveterate toxic effects on mammals produced by A.flavus and A.parasiticus ( Palmgreen and Hayes 1987 ) . Aflatoxin B1 is normally found in carnal grocery and taint occur during harvest home, storage, processing, transporting and silage. Corn, peanuts, cottonseed and rice are the chief harvests contain the high degree of Aflatoxins. Aflatoxin M1 ( AFM1 ) is the hydorxylated metabolite of Aflatoxin B1 in the milk. This metabolite was foremost detected in cow milk. It had been fed the contaminated maize and peanut by Aflatoxin B1. There is a relationship between the sum of AFM1 in the milk and ingestion of contaminated grocery by AFB1 ( Sassahara et al. , 2005 ) . After consumption and digestion of AFB1 by ruminant, it is synthesized to AFM1 in the milk. Metabolizing of AFM1 occur in animate being s liver ( Frobish et al. , 1988. , Van Egmond and Paulsch, . 1986 ) . Previous studied have been estimated that about 0.3- 6.2 % of AFB1 in animate being s ration convert to AFM1 in milk ( Creppy, 2002 ) . AFB1 transition to AFM1 includes four stairss. The carcinogenic authority and toxicity of aflatoxin M1 is 10 times less than aflatoxin B1 but the acutely hepatotoxic is same as AFB1 ( Cullen et al. , 1987 and Lafont et al. , 1989 ) . The European Commission ( EC ) has accepted a bound of 50 ng/l for AFM1 for milk ( European Commission, 2001 ) while the US nutrient and Drug Administration ( US FDA, 1 996 ) has recommended the maximal degree of 500 ng/l for AFM1 in milk. In existent fact, taint of milk and milk merchandises by AFM1 depends on several environmental factors such as season, geographics, state. The degree of AFM1 in dairy merchandises is variable between hot and cold conditions. In spring and summer, animate beings are fed by grass, grazing land, weed while in winter dressed ores used less than leafy vegetables. It causes a autumn in AFM1 degree ( Galvano et al. , 1996 ; Pitet, 1998 ; Sarimehmetoglu et al. , 2003 ) . In old surveies, AFM1 is non destroyed during the heat processes like pasteurization or alterations are non obvious ( Yousef and Marth, . 1989 ) . Besides, in yogurt and cheese production the pollution degree of AFM1 does non alter and remains stable. ( BARBIERI et al, 1994 ; CREPPY, 2002 ; GALVANO et al. , 1996 ; PITET, 1998 ) . Another survey has been confirmed 9 % of addition in AFM1 when the yogurt was produced from contaminated milk ( Van Egmond et al. , 1977 ) . The best manner to avoid the presence of AFM1 in dairy merchandises is to command the carnal grocery during crop, storage and maintain them in suited status to forestall AFB1 formation. Different methods and factors are available and have been tested before to detoxicate the aflatoxins from nutrient and provender stuffs. Three methods are common to utilize to degrade the degree of aflatoxins in nutrients and provenders. Chemical, mechanical and biological methods are applied to diminish the degree of taint in different types of nutrients. The FAO needs some conditions to accept the decontamination procedure. Any detoxification process must extinguish, demobilize or destruct toxins. Decontamination method should non bring forth any toxic in the concluding merchandises. These methods must take any fungous spores that could increase and bring forth new toxins. In physical detoxification, heat interventions, gumma radiation, UV or seeable visible radiation are applied. Chemical debasement is more practical and reasonable method. Sodium bisulphate Converts AFM1 to H2O soluble merchandise ( Doyle and Marth, . 1978, Hagler et al. , 1982 ) . Treatment with ammonium hydroxide, Ca hydrated oxide, methanal and clays are the chemical methods to cut down the hazard of aflatoxicosis. Some strains of lactic acid bacteriums ( LAB ) and barms have been reported to degrade of aflatoxins level in dairy merchandise ( El- Nezami et Al. , 1998 a ) . Work Plan In this research, the biological method will be applied to adhere the ability of AFM1 in milk and yoghurt. Two types of Lactic Acid Bacteria ( LAC ) , Lactobacillus delbrueckii subsp. Bulgaricus and Streptococcus thermophilus, will be used for this intent. Lactobacillus delbrueckii subsp. Bulgaricus is used for yoghurt production and found in other fermented merchandises. This strain is regarded as acidophilous bacteria PH ( 4.6- 5.4 ) and unable to ferment any sugar except Lactose. During fermenting to yogurt, it produces ethanal that is one of the yoghurt olfactory property elements. Streptococcus thermophilus converts lactose to lactic acid and ethanal. It is counted as a probiotic. In add-on, this strain alleviates the symptoms of lactose intolerance. In this method, samples of assorted types of milk and yoghurt will be collected from different stores. Whole milk, semi-skimmed milk, skimmed milk, low fat yogurt and high fat yogurt are traveling to be used in this research. The research processes include, civilization readying, taint with AFM1 in PBS, milk taint with AFM1, yogurt taint with AFM1, statistical analysis and consequences. At first, Lactobacillus delbrueckii subsp.Bulgaricus and Streptococcus thermophilus is cultivated and incubated so these bacteriums are centrifuged and washed with buffer. The following measure is suspending bacterial pellets in PBS, which is contaminated with AFM1. Then the bacterial pellets is incubated and centrifuged. Extracting the unbound AFM1 will be done by Immunoaffinity Columns ( IAC ) method and the process will be completed harmonizing to R-biopharm GmbH recommendation. This method will be repeated in milk and yogurt samples. Again, prepared bacterial pellets will be suspended in contaminated milk or yogurt with AFM1. Removing the unbound AFM1 will be done by IAC method after the incubation and extractor of milk and yoghurt samples. The statistical analysis will be based on the discrepancy comparing. Differences between discrepancies show the difference between adhering sums of AFM1 in two medium of two bacteriums. ANOVA and DUNCAN trial are suggested analyses methods in this research. The most of import thing in this undertaking is showing the adhering ability of LAB. Which type of these two strains has a more binding ability in comparing of another one? In add-on, another mark of this undertaking is to place the binding ability of milk and yogurt. Which merchandises adhering capableness is much greater than other? Alternatively, does the sum of fat have any consequence on AFM1 debasement? All the consequences will be discussed. The biological and chemical environment of each merchandise must be considered. To happen out the chief ground several factors must be intended. For illustration, medium PH, available enzymes in the merchandise, agitation, types of protein in each merchandise, sum of fat and type of bacteriums. To accomplish the best determination, utilizing the old researches related to this topic is advised. After accurate probes and sing all facets of this research, the concluding decision will be suggested. Different methods are available to pull out the unbound AFM1 from supernatant. Thin Layer Chromatography ( TLC ) , High Performance Liquid Chromatography ( HPLC ) , Enzyme Linked Immunosorbent Assay ( ELISA ) and Immunoaffinity Columns ( IAC ) . Immunoaffinity column is the most suited method for this research. This method purifies the substance from a mixture into a buffering solution, cut down the sum of substance in a mixture and purify and concentrate the enzyme solution. OBJECTIVES A ; GOALS The end of this undertaking is to diminish the degree of AFM1 in dairy merchandises with biological method to avoid the harmful consequence of this aflatoxin and suggest the new technique for this planetary job. The chief aims include: O Roll uping the samples O Fixing the LAB and AFM1 O Adding the LAB and AFM1 to supply samples O Detecting the unbound AFM1 with IAC method O Statistical analysis by ANOVA and DUNCAN trial O Geting the consequences To avoid prejudice in this undertaking some facets must be considered O Choosing the appropriate statistical trial O Sing the immaterial factors O Accuracy in sample collection O Applying sufficient volume and degree of used stuffs O Sing the truth of used equipments Timeline No Activities Date 1 Submit Grant Proposal December, 2009 2 Expected Grant Notification January, 2010 3 Provide Laboratory February, 2010 4 Obtain Materials and Equipments March, 2010 5 Project Start up April, 2010 6 Prepare Results Report June, 2010 7 Submit Project July, 2010 BENEFITS OF RESEARCH Aflatoxin M1 has been related with assorted diseases. It is diagnosed farm animal, domestic animate beings and homo in the worldwide. Certain environmental factors cause the happening of aflatoxins in animate beings. Such as geographical location, agricultural and agronomic process, bring forthing of Fungis that cause mycotoxins presence during preharvest, storage and processing. Aflatoxin M1 cause liver and kidney disfunction and malignant neoplastic disease in animate being and human. These are well depends on age, sex, species and nutrition. Clinical symptoms in carnal include ammonium hydroxide, reduced reproductivity, disfunction in nutrient use and GI jobs Evidence of aflatoxins wellness impact on homo has been reported from different country of universe particularly in 3rd universe states and the acute status of disease leads to human decease. Overall, because of all the issues that mentioned above aflatoxins have the irreparable impact on the universe economic system. Ineluctable presence of aflatoxins in nutrients and provenders and do the harmful consequence on homo and animate beings leads to detect and research the new methods for detoxification and degrading of these mycotoxins. In this undertaking, it is attempted to measure the consequence of lactic acid bacteriums on diminishing the degree of AFM1 in milk and yoghurt. If the result can be acceptable, it will be used for the remotion of AFM1 from dairy merchandises. The other account to utilize LAB for decontamination of AFM1 is the side effects of some mechanical and chemical methods. These techniques are non appropriate to use in dairy merchandises and the biological method in these instances has been advised Budget MATHERIALS 1 SOLID AFM1 ( SIGMA ) ?200 2 Lactobacillus delbrueckii subsp. bulgaricus ?250 3 Streptococcus thermophilus ?250 4 Phosphate Buffer Saline ( PBS ) ?100 5 Milk A ; Yoghurt ?50 6 Incubator ?1000 7 Centrifuge ?2500 8 Pipets 1-10 milliliters ?200 9 UV Light box and beginning ?500 10 Other equipments ?300 11 TOTAL ?5350 IAC EQUIPMENTS AFLASCAN KIT COMPONENTS 1 Aflascan unsusceptibility columns ?150 2 Florisil tips ?200 3 Glass syring barrel ?100 4 Plastic syring pump unit ?150 5 Rubber connection ?100 6 Fluroscent comparator card ?300 7 Sum ?1000 PROJECT MANAGEMENT

Saturday, February 22, 2020

Consideration Essay Example | Topics and Well Written Essays - 1000 words

Consideration - Essay Example The extant practice of the courts is to reject a transaction even if there is consideration for the promise; if it is illegal in nature. Furthermore, it has become accepted practice to refuse enforcement of a promise, for the reason that it had not been the objective of the promisor to create any legal association by that promise. As such, consideration is no longer perceived to be a concise term that indicates the presence or absence of justification for enforcing a promise2. Albeit, consensus demands unconditional acceptance of an offer, consideration is also required, if a valid contract is to come into existence. Consideration is related to various legal concepts and provisions. A mere inclusion of consideration in the contract is insufficient to make it valid. Consideration should be either in a monetary form or in a form that can be estimated monetarily. A promise that lacks consideration is not capable of being legally enforced3. In general, the provision of goods or services constitutes the consideration on account of one of the parties to the contract. The other party pays money for these goods or services. Agency law terms such financial consideration as commission. Such consideration is known as price in sale of goods; receipt of wages or salary by employees in employment contracts; freight in the carriage of goods; and premiums in insurance contracts4. As such, persons, who are under a legal obligation to perform some duty, need not be provided with consideration, in order to perform the same. This is due to the reason that they are legally bound to complete the duty. Thus, anyone who is under a legal obligation to do something cannot make a good consideration by merely completing it. Performing a duty beyond a person’s legal obligation can constitute good consideration. This principle was established in

Thursday, February 6, 2020

Purification and charcaterization of extracellular cysteine protease Article

Purification and charcaterization of extracellular cysteine protease inhibitor, ECPI2, from chlorella - Article Example First, they cultured a strain of Chlorella sp. 4533, separated the filtrate by centrifuge, and concentrated it through evaporation. After assaying the protease activity, they eluted the inhibitor and obtained two active fractions, one of which was the primary research component, ECPI-2. The active fractions of this were pooled, dialyzed and concentrated, and then the protein concentration and carbohydrate content were determined and measured. 4. Discussion of Figures and Tables. Table 1 is the purification summary for ECPI-2, providing comparison of progressively purified elements in terms of protein concentration, total and specific activity, and percentage yield from crude of each step in the purification process. This was performed to purify the inhibitor and demonstrate the increasing level of activity. The first step used a DEAE-cellulose column of 3.5x60 cm and quadrupled the specific activity. Next, after the active elements were pooled, dialyzed and concentrated, they were applied to a Sephadex S-300 column (2x130 cm) which increased specific activity by a factor of almost 5X. Finally, after another evaporator concentration, the inhibitor was applied to a 1x150 cm column of Butyl Toyopearl 650 M, again doubling the specific activity; from crude to final, activity was increased by over 40X, giving the authors evidence of purity.

Tuesday, January 28, 2020

High school Essay Example for Free

High school Essay CHAPTER ONE 1. 0 INTRODUCTION In an effort to improve universal access to education, the ministry of education made a decision to introduce the re-entry policy. The policy is meant to accord girls who drop out of school owing to early pregnancy an opportunity to be re-admitted six months to one after delivery. This initiative has since scored a number of successes as some girls have gone back to school and successfully completed their secondary education , though some, order the age initially would have done so, Fifth National Development Plan(2006-2010). Before October 13 1997, it was considered an expellable offence for girls who fell pregnant while at school. But the re-introduction of the re-entry policy on that date was a measure and recognition of the importance of addressing gender inequalities in national development and the need to narrow down the gender gap in the education, Ministry of Education (1996). Child pregnancy has been persistent factors in household and hence, the re-entry policy has enabled government and families to recoup the investment made in educating such girls and that the nation has been accorded the much needed educated human resource for national development. 1. 2 STATEMENT OF THE PROBLEM There has been a marked increase in the Forum for women educationist of Zambia has endeavored to play in the support and sensitization of the re-entry policy in enhancing girl child education in Zambia. However, despite this increase not all have been able to go back to schools. This is a serious omission particularly when a good number of girls can utilize the given opportunity and when concerted effort has been made to enhance girl child education. In addition, all efforts and resources pumped in will go to waste. 1. 3 THE PURPOSE OF STUDY The purpose of this study is to find out the role FAWEZA is playing in promoting the reentry policy in enhancing girl child education and to find out the response of the policy by the girl child. 1. 4 OBJECTIVES OF THE STUDY †¢ †¢ †¢ †¢ †¢ †¢ To find out the role of FAWEZA in promoting the re-entry policy. To find out whether school managers do comply with the policy. To find out the response of the re-entry policy by pupils. To find out whether the re-entry policy is a success or failure. To find out whether teachers and parents support the policy. To find out measures in improving the re-entry policy. 1. 5 RESEARCH QUESTIONS †¢ †¢ †¢ †¢ †¢ †¢ What is the role of FAWEZA in supporting the re-entry policy? Do school managers comply with the policy? What is the response of the re-entry policy by pupils? Is the re-entry policy a success or failure? Do teachers and parents support the re-entry policy? What measures can improve the re-entry policy? 1. 6 SIGNIFICANCE OF THE STUDY The study’s findings and recommendations may assist the Forum for Educationist of Zambia FAWEZA and the Ministry of Education in promoting and supporting the re-entry policy in enhancing girl child education in Zambia. 1. 7 LIMITATIONS OF THE STUDY Because it was an introduction to research at degree, this research only covered a small part of Lusaka urban district. Secondly, money was a problem to access at the right time hence it delayed the process of collecting data. However, the researcher tried by all means to use the available resources, time to make sure that this is a success. @siamef Page 2 1. 8 DEFINITION OF TERMS ENHANCE; To improves or adds to strength. RE-ENTRY; An act or instance of somebody going back to enter. POLICY; A set of principles on which they are based @siamef Page 3 CHAPTER 2 2. 0 LITERATURE REVIEW 2. 1 Policy Formulation In contrast to the policy of exclusion that preceded it, the re-entry policy advocates that girls who drop out of school due to pregnancy should be readmitted after giving birth. The aim of this policy is to find more innovative measures to help prevent the exclusion of young mothers from education. In the event of a girl being forced out of school due to pregnancy, the Ministry of Education in Zambia has provided policy guidelines to assist schools and other stakeholders such as FAWEZA etc. †When the women’s movement in Zambia grew in strength, one of the issues they decided to fight for was injustice for girls who were thrown out of school after getting pregnant. In June 1995, the Zambia Association for University Women organized a conference on the situation of the girl-child in Zambia. The conference, which was held in preparation for the Fourth World Conference on Women, proposed to government that girls who became pregnant should be re-admitted into school once care for the child was assured† (FAWEZA, 2008, Ministry of Education, 2009). The policy is grounded in the outcomes of the Beijing Conference of 1995, a conference at which the Women’s Movement drew up its own priorities and action plan. The conference demanded that girls who dropped out of school because of pregnancy should be readmitted. In addition to this, Zambia is a signatory to most of the international instruments that promote the rights of children and women. The country recognizes education of all children as a basic human right as enshrined in Article 26 of the United Nations Universal Declaration of Human Rights. It further recognizes education as a right that is also guaranteed by the policy of Education for All (EFA), the United Nations Convention on the Elimination of Discrimination Against Women (CEDAW), the United Nations Platform for Action, and the Millennium Development Goals. In addition to the international instruments, major national policy developments within the education sector were initiated, culminating in the development of the third Ministry of Education (Moe) policy on education in the document â€Å"Educating Our Future† (1996). In 2000, the government adopted a National Gender Policy. The policy states that it will facilitate the readmission of girls who become pregnant back into school as a way of readdressing imbalances and inadequacies in the provision of education. The 2001 FAWEZA @siamef Page 4 workshop made a number of recommendations to improve the implementation of the re-entry policy. The recommendations were sent to the Ministry of Education for approval. Though there was no official acceptance, some of the recommendations were adopted, and that has made the policy work well, (FAWEZA, 2010) 2. 2 Response of the Policy In Zambia, some girls, especially in rural and peri-urban areas, fail to continue with their education as a result of teenage pregnancies. Although the Ministry of Education has a policy of allowing teenage mothers to go back to school after delivery, few are doing so. They find it difficult to leave their babies and stay in school for eight hours and are often ridiculed by others. The men responsible for their pregnancies often abandon them without any form of support. Unlike boys, a girl-child seems to have so much on her shoulders. This is due to cultural inequalities that continue to define societys way of life. Maybe this should be the focus of most of the gender discussion going on. Some girls in rural areas who fall pregnant are normally kept at home to help with domestic chores, or care for terminally ill parents. Others are forced into early marriages and thus denied the opportunity to further their education. Government, through the programme, has been seeking to bring teenage mothers back to school. Educating a girl-child has been a high priority for the Zambian Government, (Zambia Online). In realizing the re-entry policy, FAWEZA (2009) reports that† Interviews with girls also revealed a high level of appreciation for the policy among schoolgirl mothers who had reentered after giving birth. They reported that they were grateful that the policy had given them a second chanceâ€Å" Achievements highlighted by the head teachers and teachers were with regard to the increased number of girls who were readmitted after giving birth each year and the level of awareness of the policy by the parents who sent back their daughters after giving birth. These positive stories are set however against the background of the high number of girls who fall pregnant before finishing school each year. 2. 3 Successes and Failures of the Re-entry Policy Despite the policy being put in place in Zambia, an increasing number of girls do not return to school after giving birth. Social economic and cultural factors have been commonly cited as reasons for this failure. The annual statistics from the Zambia Ministry of Education @siamef Statistical Bulletin shows increased number of pregnancies. In addition, data from the Zambia Page 5 Demographic Health Survey (CSO, 2007) reveals that each year approximately 30% of the girls who drop out from school, do so because of pregnancy. The main reason stated for dropouts is the lack of financial support. The survey reveals that generally girls from disproportionately poor backgrounds drop out of school due to pregnancy compared to those from better off households. The survey shows a link between poverty and early adolescent pregnancy, which consequently leads them to be temporarily excluded from school. Zambia has seen a tremendous increase in access to education with pupil’s enrolments growing Over 9% since 2000. Further, the illiteracy rate in Zambia has been halved over the past three Decades from 90% to 45%. In addition, in the past two decades, Zambia has vigorously embarked on formulating interventions to eliminate gender based discrimination against girls and women as a strategy towards creating more equal societies, FAWEZA ANNUAL WORK PLAN (2012). Despite this achievement, many challenges remain in education delivery in Zambia. There is a huge gap in reaching the millennium development goals (MDG) and Education for All (EFA) goals by 2015. This particularly is a challenge given the country’s significant population growth and deep poverty. In addition, gender inequality is a long way from being realized. Despite the significant rise in female enrollment at primary school, fewer, female compared to male, enroll in high schools (particularly in rural areas) as many tend to drop out before completing secondary school. According to the FAWE ANNUAL WORK PLAN (2005-2009), â€Å"Despite the challenges in the re-entry policy, the government-civil society interaction and the consultative process in Zambia represent one of the best-practice cases in sub-Saharan Africa. The policy is appreciated by a broad spectrum of people. Internationally, Zambia has been cited as a best example for implementing the policy. Representatives from a number of countries in the region, including Malawi, Botswana and South Africa have come to Zambia to learn about policy implementation. † Interviews with the ministry of education DEBs, the national coordinator from a civil society organization (FAWEZA), head teachers, teachers and pupils indicated a high level of optimism for the ultimate success of the policy. Schools confirmed that the â€Å"re-entry policy is a good policy and indeed a historical watershed to the government of Zambia†. FAWEZA has provided 4,750 scholarships at basic, high school and tertiary levels in ratio of 7:3 girls and boys respectively. With the aim of improving the performance, retention and contribute to progression and pass rates of boys and girls on the scholarship @siamef Page 6. programme, FAWEZA has created and continued supporting 390 Study Groups at upper basic school level and high school levels. FAWEZA will also facilitate the showcasing of the repackaged SMT Tele quiz DVDs in 25 schools aimed at inspiring girls to take up SMT subjects. The activity is intended to help FAWEZA track the impacts of using the media to sensitize communities, girls and women that girls are capable of performing well in SMT subjects as the boys. 2. 4 Compliance of the Policy by School Managers. According to the Strategic Plan close out Report (2005-2009:20) â€Å"The creation of gender responsive school environments is cardinal in fostering access, retention and completion of girls in their education. In consideration of this, FAWEZA conducted training for 40 High School Managers in guidelines for gender responsive school environments and gender analysis and mainstreaming, while 58 female school managers took part in training in public image projection, which included role modeling, public speaking force field analysis and gender budgeting. Further, using the MOE/UNICEF Girl-Friendly school module, provincial executive members and CWA members were oriented for them to orient school managers; Out of 63 school managers invited to the gender mainstreaming training, 54 attended; Various PECs and DECs met the newly appointed PEOs and DEBS to solicit support. † Hence if such interventions are being carried out, various doors will be open to allow the success of the policy. @siamef Page 7 CHAPTER THREE 3. 0 Research Methodology The purpose of this chapter is to show how this study was conducted. It looks at the instruments used. The methodology gives in depth principles used to analyze and collect data in the research. This is a qualitative case study research that makes extensive use of primary and secondary data. 3. 1 Research Design The research design which was used in this study was the descriptive survey. This study was aimed at collecting information from respondents on the role of FAWEZA and the re-entry policy in enhancing girl child education in Zambia. The researcher used both primary and secondary data. Primary data was obtained through interviews with the FAWEZA representative, DEBs and administering questionnaires to Head teachers, teachers, Parents and Pupils while secondary was found from the internet, policy documents, statistical bulletins, books and magazines. 3. 2 Description of the sample. The proposed study targeted a sample of fifty (50) respondents. The sample included representatives of FAWEZA, DEBs, Ten (10) parents, five(5) teachers, five(5) guidance and counseling teachers, twenty(23) pupils and five(5)school managers. The sample was drawn from five schools namely Matero Girls High school, Kamwala High school, Olympia Park High school, Kabuionga Girls High school and Libala High school within Lusaka urban District. In this study, purposive sampling was used in which both male and female were used in data collection. 3. 3 Sampling Procedure The study was purposively sampled on the basis of public secondary schools that had girls. The sampling of the schools was also purposive; this was done with the help of head teachers who reported that their schools had student-mothers enrolled or pregnant girls that dropped out of school. Of the several schools in Lusaka urban District; 5 schools were chosen. However, due to the fact that schools closed, the pupils were drawn from those that used to go for studies during holidays. While the head teachers of the five schools confirmed having had schoolgirl pregnancy cases in their respective schools. @siamef Page 8 3. 4 Description of Research instruments In the process of data collection, in depth interviews and questionnaires were administered. The use of both instruments formed a complementary approach towards collecting data using qualitative type of research 3. 5 Data Collection In this study, in depth interviews were carried out to the representative of FAWEZA and the DEBs because detailed information was needed. Questionnaires were administered to school managers, parents, teachers and pupils 3. 6 Data Analysis Data analysis commenced after the process of data collection exercise. This included systematic arrangement of data from the field. This study is more qualitative to the perspective of the objectives and hence making qualitative research more reliable. 3. 7 Questionnaires In this instrument,  data was covered over the required sample. The content of the Questionnaires included: †¢ †¢ †¢ †¢ †¢ Respondent’s role on the re-entry Policy in enhancing girl child education. Respondent’s compliance on the re-entry policy. Respondent’s support of the re-entry policy Respondent’s view on the measures to improve the re-entry policy. Respondent’s knowledge of the re-entry policy. 3. 8 Interview Guide Semi-structured interview were used as the main research technique in this study. The interviews covered various questions such as; †¢ †¢ †¢ †¢ The role of FWEZA in the re-entry policy. Measures to improve the re-entry policy. Successes and challenges of the policy. Compliance of the policy by school administrators. Page 9 @siamef CHAPTER 4 4. 0 Findings and Discussions of the study. This section presents research findings based on the data collected from the DEBs; FAWEZA; head teachers; teachers ,parents and students from Matero Girls High School; Olympia Park High School; Kamwala High School; Libala High School; Kabulonga Girls High school in Lusaka urban district of Zambia. The findings are given under full heading derived from the objectives of the study. 4. 1 The role of FAWEZA in the re-entry policy The FAWE representative was interviewed on the role that FAWEZA plays in the re-entry policy by enhancing girl child education in Zambia. The representative confirmed of the major role that FAWEZA has undertaken in the support and implementation of the re-entry policy. In realizing the re-entry policy guidelines, the organization has realized various initiatives to bridge the persistent gender gaps in education. To mitigate the problem, the organization conducts various initiatives. Some of the actions that are being undertaken include: †¢ Advocacy to ensure pregnant girls go back to school after giving birth and they mix freely with other pupils. †¢ Guidance and Counseling services are being offered to girls who fall pregnant in all the schools. †¢ Bursaries are offered to girls, orphans and vulnerable children. FAWEZA has been able to take over the financial responsibility for some of the most vulnerable girls. The support does not cover only the school requirements. A little extra money is given for the girls’ toiletries. Some of the girls who have had children fall into this category and benefit from the support, too. Girls who may have stayed away from school for financial reasons have been able to continue their education. Affirmative action for girls which lowers entry points into higher grades and tertiary have been implemented †¢ Workshops and discussion forums are being held to discuss challenges encountered by implementing the policy and how these can be addressed in order to reduce gender imbalance in the education sector. @siamef Page 10 †¢ Stiffer Rules have been instituted in schools that protect girl children from Gender Based Violence and other abuses. Schools have come up with strategies to help girls avoid pregnancies. One of them was Kabulonga Girls in Need Association. A teacher who saw the need for girls to talk about the problems they faced started the club. He adopted tactics that helped the girls gain selfconfidence. When FAWEZA visited the school, it was impressed by what had been achieved. The school was asked to transform the club into SAFE, an American concept that stands for the Student Alliance for Female Education. SAFE clubs, which are student networks for the promotion of female education, operate under the auspices of FAWEZA. SAFE aims to use peers or mentors to improve the wellbeing of the girl-child. The mentors come from institutions of higher learning such as the University of Zambia and the Evelyn Hone College. Girls who volunteer to become mentors are trained in adolescent reproductive health and counseling. They counsel victims of abuse, STI/HIV/AIDS and other related cases. The mentors help the club members to: ? Take responsibility and make informed choices ? Resist negative pressures ? Build their self -esteem ? Discuss issues affecting them openly and freely ? Avoid risky behavior The Kabulonga SAFE club has become a national model. SAFE clubs have been opened throughout the country. They now admit boys as supporters. This will help the boys and girls to work together and grow to respect each other. The clubs are helping remove the stigma against re-entry girls. Another intervention introduced by FAWEZA is the Communication Box. A locked box stands outside the school. Girls drop suggestions or complaints into the box. Only teachers trained by FAWEZA are allowed to open the boxes. If there are allegations against the school for further action. This has reduced cases of verbal and other abuse by teachers and students alike, FAWEZA REPORT (2004). @siamef Page 11 4. 2 Evaluation whether school managers comply with the policy In response as to whether school managers comply with the policy, respondents who responded to the Questionnaires and interviewed agreed that the Head teachers in their schools complied with the policy. Of the (5) school managers interviewed in the five (5) different schools,(100%) reported that they actually comply with the policy and follow the reentry policy guidelines. This can be attributed in the high increase in the enrollments rates. The Head teachers comply with the policy through the following processes. 4. 2. 1 Readmission of girls who dropped out. The head teachers reported that they have massively been recruiting the young mothers who had actually dropped out of school due to early pregnancies. They said they have been doing so in order to support and comply with the policy guidelines because they were involved in the formulation of the policy at its initial level, Hence they needed to add a hand in the support of the policy. The head teachers added that they do not hesitate to readmit the girls who had dropped out of school due to pregnancy or finance but the girls are supposed to produce the documents granting maternity leave and the medical report confirming pregnancy. 4. 2. 2 Moral support, encouragement and equal treatment. The head teachers reported that they have been offering moral support, encouragement and equal and fair treatment to the teen mothers with the rest of the students through the Guidance and counseling teachers in the schools. From the findings obtained, it was confirmed by the key informants that the head teachers comply with the policy. However, it can be stated that the policy faced much resentment by several figures of the public. According to FAWEZA Report (2009; 14) â€Å"In the first year or two, there were newspaper reports of head teachers who would allow girls back only after intervention by the Ministry of Education. † It can be said that at the early stages of the introduction of the policy, there was much needed sensitization on the benefits of the re-entry policy in enhancing girl child education in Zambia. In one case, during the collection and sampling stage of this research with the District Education Office (DEBs), when asked if he had any cases of pregnant girls or studentmothers in the schools, he stated that he had some â€Å"unofficial cases‘ as they are yet to be @siamef Page 12 reported to his office by the girls‘ parents. Upon further probing on the issue of officialising‘pregnancy cases and why he would not take the initiative to confront such cases, he pointed out that this is due to fear of parents‘reaction to news of their daughter‘s pregnancy. Depending on the prevailing religious and socio-cultural beliefs, parents are more likely to react negatively to news of their daughters‘pregnancy. This view was shared by two other teachers from the schools that took part in this research. 4. 3 Response of the Policy by the pupils Views of the girls who responded to the Questionnaires converged with those of the head teachers, teachers, and the parents. Both categories of girls interviewed stated that the policy was good and it was well responded to although it did not address most of their concerns. When asked what their concerns were, adolescent schoolgirl mothers reported that the policy should have spelt out the need for providing counseling sessions to those who returned. They reported that while at school, they felt stigmatized by their friends and teachers through derogatory remarks such as addressing them by their children’s names: â€Å"Bana Mary (Mother of Mary), aunt Lucy etc† which made them feel out of place. It was the view of the pupils that the Ministry of Education was doing very little to enforce the implementation of the policy and ensure that girls who  returned to school were protected from verbal abuse by the teachers. At least 63% of the girls reported that they faced challenges with regard to combining the two roles of being a mother and a schoolgirl particularly when their children fell sick or needed to be taken to Under 5 clinics. They reported that they absented themselves from school and missed classes whenever they had to take their children to hospital. They further reported that the policy should have put in place mechanisms for following up those who for some reason decided not to return. At the household level, three key factors prominently influence the likely-hood of young mothers returning to formal schooling. These factors are; fathers support over the decision to return to school, the structure of the house-hold, and finally the availability of financial support from either the young mother‘s children partners or the extended family. Evidently, household characteristics and behavior have a strong effect on the re-entry policy; more so parental and community willingness to support school re-entry for the young mothers, most of whom are jurally minors. At another level, how the households interact with other institutions and the external socio-cultural environment that mediates these interactions @siamef Page 13 may affect the chances of schools re-entry. These factors have to be identified and understood by policy makers and programme managers if education for all including student-mothers is to be realized. 4. 4 The re-entry policy a success or failure FAWEZA has been successful in implementing programmes to achieve its objectives. Among them are the programs designed to improve performance, progression and completion rates such as theScholarship program that has seen 2,426 girls and 1287 boys completing the 12 year cycle. Further,a total of 27 students completed tertiary education. Further, the SMT programmes have stimulated the interest of girls in participating in the activities and are performing well. In the quizzes held in SP2005-2009 there were more girls scoping prizes than boys. In program area two, FAWEZAcontinued to sensitize communities on the policies that protect girls’ education. At school level the informants were asked if the policy guidelines were clear enough to provide them guidance for implementation, more than half (60%) of the informants, a majority of whom were teachers and headteachers (4), reported that because the policy was new, they needed to be oriented to it, before being asked to implement it. 4. 5 Do teachers and Parents support the re-entry Policy? In response to the support of the policy, (8) 80% of the parents who responded to the questionnaires were in favor of the policy. Though, (2) 20% of the parents were not fully sure of the re-entry policy guidelines. Of the teachers who were against the policy, (3) 30% were men and (7) 70% were female who reported that they fully in support of the policy. Therefore, only male teachers have remained constant in opposition to the policy. Commenting on this, one girl said the male teachers and the boys who were still against the policy were afraid of facing the mothers of their children every day. A female teacher said men like to dominate. When they see an intelligent girl, they want to curtail her education. They will do all in their power to frustrate her, including making her pregnant. Parents reported that the policy has made both boys and girls reckless. There was a feeling that the re-entry girls were in a vulnerable position because male teachers and schoolboys perceive them as having low morals. They come back with the sole purpose to study and pass their examinations. Therefore, they become better students. There is fear among some groups e. g. the parents and the teachers that the policy has led to increased cases of pregnancy @siamef Page 14  among the school girls. The policy has been looked at as a lee way to immorality because the girls definitely know that they be returned to school. 4. 6 Support of the re-entry policy When informants were asked to state the kind of support they received from the ministry to implement the policy, the DEBs and the school level implementers reported that they had received funds neither to photo-copy the circular for the parents and/or the Parents Teachers Association (PTA) nor to conduct local sensitization meetings on the policy. At the same time, the DEBs stated that the ministry was committed to ensuring that the policy gets fully implemented in all schools. Funds were planned to be set aside to conduct â€Å"massive sensitization meetings† and workshops targeted at school level and members of the public. FAWEZA organization on the other hand reported that they were planning to advocate and lobby members of parliament and some permanent secretaries to ensure that the re-entry policy be included in the Education Bill which was to be tabled in parliament in July 2010. It is evident from this finding that the policy was introduced in schools before it was discussed and enacted in parliament. The finding echoes that of Hoppers (2007) in Uganda in which he described the decision by some policy actors to implement a draft version of the policy before it is submitted to parliament. Similarly, the re-entry policy in Zambia was first declared as a policy by the then minister of education before it was discussed in parliament. 4. 7 What measures can improve the re-entry policy Respondents were asked to give measures to improve the re-entry policy. Their views were critically assessed and analyzed. In order to ensure that re-entry programmes are successful; the following measures were outlined by the respondents in implementing the policy: 4. 7. 1Political Will: The Zambian government did not capitulate, even when there appeared to be more voices against the policy, than those which support it. It maintained that expelling pregnant girls would make gender equality in the education system impossible. Hence, there is need to follow the political will of the nation @siamef Page 15 4. 7. 2 Guidelines: Availability of proper guidelines on how re-entry policy will be conducted is very essential. The guideline development should involve all stakeholders including the teen-mothers. The policy should be geared upon providing an opportunity for these girls to obtain another chance into the education programme and not to perpetuate immoral behavior. 4. 7. 3 Acceptance of Change: There is a need for community to change and accept that this program is for the benefit of the girls and the community at large. In Zambia after seeing the benefits of the program many families have accepted and supported their children. 4. 7. 4 Financial Support Not only to take over the financial responsibility for some of the most vulnerable girls. A little extra money to be given to the girls’ for other needs such as sanitary pads is essential. Some of the girls who have had children fall into this category and can benefit from the support, too. Girls who may have stayed away from school for financial reasons can continue with education. There is great awareness that there is a fear among people that re-entry of young mothers to school might influence others to immoral behavior knowing that they will also be readmitted if they get pregnancies. But studies in the area have shown that there is no concrete evidence which reveal constructive societal returns from expelling pregnant schoolgirls and young mothers from education. However, parents, community and the government at large should provide life skills education for girls and boys to make them aware of effects of pregnancy and should be encouraged to be more responsible for building their future through education achievement 4. 7. 5 Strengthen rules regarding the policy. Regarding the strengthening of the rules, 45 (90%) of the informants reported that there was need to strengthen the rules. In Zambia, the policy guidelines states that once the girl has been given maternity leave, the father should also be suspended from school until the girl returns to school. If the teacher is the one responsible for the pregnancy, it states that the teacher should be disciplined.

Monday, January 20, 2020

The Lottery Essay -- essays research papers

â€Å"The Lottery†   Ã‚  Ã‚  Ã‚  Ã‚  Ã¢â‚¬Å"The Lottery† was quite disturbing to read. It is an very unusual story that has an ending that will have you baffled. You will want to reread certain parts to see if there is anything thing that you could have missed. The title of the short story is also misleading. In most cases the lottery is a good thing. People don’t win punishment and lotteries don’t hurt them. But in this story it does just that. The author did a great job of telling how anyone and everyone can follow tradition blindly. It is dangerous not to have a mind of your own and to just follow the crowd even if you don’t understand on agree on why something is happening.   Ã‚  Ã‚  Ã‚  Ã‚  The first thing that catches the eye while reading this is when the little boys start stuffing their pockets with stones when they arrive there. â€Å"Bobby Martin had already stuffed his pockets full of stones, and the other boys soon followed his example, selecting the smoothest and roundest stones† (264). This is a great example of the mere blindness in following ridiculous traditions. The young boys who started getting stones ready as soon as they got there could not have fully understood the tradition. They could have not understood the complete purpose of the stones. They have seen the adults pick stones in years before and have followed in their footsteps without question as if it were some sort of game.   Ã‚  Ã‚  Ã‚  Ã‚  The official of the lottery is ...

Sunday, January 12, 2020

Alcohol advertisements should be banned Essay

Alcohol is the ingredient found in beer, wine and spirits which causes drunkenness. Abuse of alcohol, or consumption of more alcohol than the body can handle, can lead to liver damage and other debilitating conditions. Alcohol abuse can also lead to alcoholism, or alcohol addiction, in which a person becomes physically and psychologically dependent on alcohol to the point that he or she cannot function without it. Alcohol advertisements can be seen virtually anywhere; they are especially known for sponsoring sporting events, concerts, magazines, and they are found anywhere on the internet. Excessive alcohol consumption is unquestionably bad for one’s health. Numerous researchers indicate that alcohol consumption on a regular basis destroys the liver and oesophagus. Thus alcohol advertisement in the print media and cinemas which encourages one to consume alcoholic drinks should be banned. In addition, alcohol advertisements are proven to have a huge influence upon teenagers. These advertisements are played a lot during TV shows watched by youngsters such as football or the ashes today. Television, cinemas and billboards are needed to stem the tide of binge drinking among teens to reduce the amount of teens affected by the deadly outcomes of alcohol. The number of alcoholics in this country has seen an exponential increase. More and more working women too are getting hooked on drinking. Instead of relegating drinking alcohol to social occasions, there’s an increasing number of both men and women drinking alcohol excessively and regularly. Alcoholic drinks give a false sense of confidence and boldness. It is quite common to see those who had too much to drink behaving inappropriately as the alcohol makes one lose their inhibition. The media should be more meticulous in terms of its advertising content. Advertisement is an important source of proceeds, particularly advertisements related to alcohol which generates huge sums of profit for the media companies. It can begin by banning alcohol advertisements and instead run advertisements that shows the public the dangerous consequences of alcohol consumption. The money spent on consuming alcohol can be diverted into better buying products such as health supplements and health food. It is clear that advertisements directly influence alcohol consumption, so the ban on alcohol advertisements should take effect immediately. Too many families and individuals have been and are still being greatly affected.

Saturday, January 4, 2020

Prostate Cancer Stem Cells

Sample details Pages: 24 Words: 7277 Downloads: 8 Date added: 2017/06/26 Category Statistics Essay Did you like this example? Characterisation of prostate cancer stem cells Abstract Background Advances in the study of cancer cells with stem cell characteristics may enable the development of new and improved cancer therapies. Stem cell marker expression can be investigated by QPCR and this sensitive method has been used to characterise prostate cancer stem cells. Methods Prostate cancer cell lines LNCaP and C42B were grown under adherent and nonadherent culture conditions. Non-adherent culture generated prostaspheres that are enriched in stem cells. In addition, LNCaP and C42B prostaspheres were treated with Wnt3a. RNA was extracted from both adherent and prostasphere cultures of LNCaP and C42B cells. cDNA was synthesized and QPCR analysis was performed with TaqMan probes in order to examine the expression of 10 genes: Nestin, Oct4, Sca-1, BMI-1, PSA, NSE,CD44, K18, ABCG2 and c-kit. Don’t waste time! Our writers will create an original "Prostate Cancer Stem Cells | Sciences Dissertations" essay for you Create order Results Prostasphere culture caused a dramatic increase in the relative expression of ABCG2 and Keratin 18 in both cell types. Conclusion The findings suggest ABCG2 may be a valuable marker for identification of prostate cancer cells with stem cell characteristics. Moreover this technique of Q-PCR may prove to be a sensitive method of evaluating markers in cancer patients. Introduction Prostate cancer is commonly diagnosed in males over 60 and is the second most common cause of cancer death in UK in men, after lung cancer (1). Following diagnosis, prostate cancer is categorised in low risk, intermediate risk and high risk. For low risk cases treatment is usually under active surveillance while intermediate and high risk is treated by surgery and radiation. Advanced cases (presence of metastasis) treatment is by androgen ablation and it almost always produces objective clinical responses (2). However, in most patients there is relapse with the development of androgen independent prostate cancer, which is associated with a median survival, of 2024 months (3). Currently, androgen independent metastatic prostate cancer is treated by Docetaxel an anti-mitotic that extends life by an average of 3 months (3). Although, the mechanisms of prostate cancer development and progression have been extensively studied this process is not fully understood. Several genes including MYC and PTEN have been linked to the development of prostate cancer (28). However, one of the most important discoveries in the genetics of prostate cancer is the identification of TMPRSS2-ETS fusion protein that arises as a result of a genetic translocation (4). TMPRSS2 is androgen-regulated transmembrane serine proteases secreted by normal prostatic tissue and an increase in androgen level increases TMPRSS2 expression. ETS family transcription factor (ERG, ETV1, or ETV4) targets genes involved in cell transformation, growth and apoptosis. Therefore fusion of TMPRSS2 gene promoter with one of the member of ETS family results in positive dysregulation of the ETS gene. TMPRSS2-ETS fusion proteins have been speculated to play a role in the development of up to 50% of prostate cancers but not the progression to androgen independence (4). Androgen independent prostate cancer has been postulated to arise as a consequence of increase activity of the androgen receptor (AR), altered cell signalling pathways, or the survival and proliferation of prostate cancer stem cells. Recent papers have conceptualized that cancer can arise from cancer cells with the characteristics of stem cells, unlimited self-renewal and the ability to produce differentiated daughter cells (5). These cells have been termed cancer stem cells (10) and may promote tumour growth, metastasis and relapses, thus having a huge impact on patient survival. The cancer stem cell model hypothesis is that cells with stem cell characteristics accumulate genetic changes over long period of time, escape the environmental control and give rise to cancerous growth. There is good evidence that cancer stem cells cause leukaemias and it has also reported that cancer stem cells can contribute to solid tumour development in brain, breast, colon and prostate. As prostate cancer is a heterogenic disease, several distinct cancer stem cell populations maybe present in a tumour (5). On basis of this knowledge, the role of cancer stem cell is been explored in solid tumours. For instance in prostate cancer mutation of the androgen receptor may result in the growth of tumour that can sustain androgen deprivation or very low level of androgen or use alternative pathways involving growth factors and cytokines. Recent studies (6) have also identified mammary stem cells as being a potential source of breast cancer, tumour relapse and tumour metastasis. For this reason it is vital to understand the stages of cell differentiation in normal prostate epithelium and identification of cells that are involved in prostate carcinogenesis and androgen independent prostate cancer. The prostate is a glandular organ comprising of three distinct epithelial cell populations that may contribute to tumorigenesis (7). Each prostatic duct is lined by nonsecretory basal cells which form a layer along the basement membrane (figure 1). Luminal cells are the major secretory cell, producing 30% of seminal fluid components and lining the lumen of duct and acini. These luminal cells are highly differentiated and expresses prostate specific antigen, cytokeratin 8 and 18 and the nuclear androgen receptor (27). Neuroendocrine cells are also present along the basement membrane and secrete neuroendocrine peptides that support epithelial growth and viability. Vascular components and stromal endothelial cells are also present in the gland. Figure 1. Schematic presentation of the cell types within a human prostatic duct. (Adapted from Abate-Shen, C. Shen, M et al 2000) Recent evidence has suggested stem cells are also present within the prostate cancer cell population. It have been theorized that stem cells may lie in the basal layer of prostate in man and in the basal and luminal compartments in mice (19). A transient amplifying population of daughter cells arises from these stem cells and generates differentiated PSA producing cells in man. Stem cells can have different characteristics, including resistance to apoptosis and increased expression of multidrug resistant transporters (8, 23, 24, 25 ). The findings of Collins et al 2001 (9) revealed that stem cells can be distinguished from the transient amplifying cells and showed there is 2-3 fold increases in expression of surface level of integrin 21. Figure 2. Hypothetical model of stem cells showing normal prostate development and prostate cancer (De Marzo MA et al 1998). De Marzo MA et al 1998 in his paper states pluripotent stem cells are capable of differentiation and self-renewal and is present in the basal epithelium of the prostate, which contains cytokeratin 5 and 14 expressing cells (figure 2). Intermediate progenitor populations located within the basal epithelium expresses both basal and secretory cell characteristics (11). Intermediate cells with limited proliferative capacity can differentiate into mature secretory luminal (androgen receptor positive) or neuroendocrine cells which are non-proliferative. In prostate cancer, it is proposed that transformation occurs which leads to the proliferation of cells with stem cell characteristics and the production of an excess of cells with luminal characteristics (Bisson and Prowse 2009). Normal murine prostate stem cells have been functionally identified by their ability to form prostate spheres (13) and to form differentiated prostate tubular structures when returned to an in vivo environment (13, 14). The in vivo generation of prostate structures from normal human prostate cells in xenograft studies and the ability to isolate a human basal prostate cell population with enriched capacity for prolonged clonal expansion and luminal differentiation have led to the hypothesis that normal human prostate stem cells are located within the basal layer of the gland (15-18). English HF et al 1987 (19) in an experiment found following androgen ablation of rodent prostate glands the stem cells exhibited regenerative properties especially of the secretory cells indicating these cells are self- sustainable, which supports the hypothesis that stem cells reside within the basal layer of the gland and are able to survive in absence of androgen environment. These cells may also therefore have the ability to survive androgen deprivation therapy and contribute to the development of metastatic prostate cancer. At present proper characterization of stem cells has been limited by the absence of specific markers that distinguishes stem cells from their more differentiated progeny. Gene expression and microarray profiling may be able to identify specific markers. These markers may also be prognostic for patient response to therapy and survival. Past papers have discussed non-adherent culture media techniques to isolate neuronal, colon and breast cancer cells that exhibited stem cell characteristics. In a recent paper by Bisson and Prowse et al 2009 (10) the authors studied prostate cancer cell lines (22RV1, DU145, PC3, VCaP, LNCaP and the LNCaP subline C4-2B) and were able to form prostosphere in non adherent culture conditions. Prostosphere were able to form from both AR positive (LNCaP, VCaP, 22RV1) and AR negative (PC-3, DU145) cell lines. Analysis of marker protein expression of proliferation (ki67) and differentiation (keratin 18 and PSA) of prostosphere revealed that cell heterogenecity existed within the prostaspheres, which may be due to different percentages of stem cells within the cell lines or maybe related to adaptation to their environment in the nonadherent culture conditions. Immunoflourescence (Figure 4) of these prostospheres with stem cells associated markers (CD44, CD133, ABCG2) showed increase in expression compared with the adherent cultures, consistent with enrichment for stem cells. However this analysis was only performed by immunofluorescence, and was limited by the semi-quantifiable nature of this technique and the antibodies available (10). Aim Quantitative analysis of cells with stem like characteristics in prostate cancer has not been attempted yet. The aim of my project is therefore, quantitative PCR (QPCR) analysis of stem cells associated gene expression of the prostosphere compared to that of the adherent culture. Material and Methods For my project I used the prostate cancer cell lines DU145, LNCaP and the LNCaP subline C4-2B. The prostasphere formation (P0) is highest in the cell types of LNCaP and its androgen independent derivative C42B, which both express AR and PSA (23). I conducted my experiments by real time PCR to measure the mRNA level of expression on cDNA extracted from prostasphere of LNCaP and subline of LNCaP, C42B cell line. This assay is both qualitative and quantitative and allowed me to compare the RNA gene expression in relation to the control (GAPDH). However there are certain limitations of using this method in my experiment. The prostasphere is heterogenic and the stem cell population within probably only a small fraction of the cells. Therefore it will be interesting to see how this affects the gene expression of the mRNAs. Cell Culture Prostate cancer cell lines LNCaP, C42B and DU145 were cultured at 37C in RPMI using 10% fetal bovine serum (Invitrogen), 2.4 mM glutamine (Sigma-Aldrich), 1% (v/v) pyruvate (Sigma-Aldrich), penicillin and streptomycin (50 U and 50 g/ml) (Invitrogen). Trypsin (Sigma-Aldrich) was used to detach adherent cells, prior to cell counting, passage or analysis (10). Prostasphere cultures were established on low attachment 6-well plate (Costar) when single cells were plated in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen) and grown under these conditions for 6-12 days (Bisson and Prowse 2009). These proliferating spheres of cells are enriched for stem cells (Bisson and Prowse 2009) and were prepared for these experiments by Dr Prowse. The prostasphere medium was also supplemented with WNT3a at 20g/ml (RD Systems) and the Hedgehog pathway inhibitor cyclopamine for 6 days prior to analysis. RNA Extraction RNA was extracted from prostate cancer cell lines LNCaP, C42B and DU145 cells (stored at -70C and thawed at 37c before extraction) using RNeasy Kit (Superscript II enzyme and Poly-A primer) from Qiagen. 600l of RLT Plus (10l of -mercaptoethanol was added to 1ml of RLT Plus buffer prior to the experiment) was added to the cells. The lysate was then added to the QIAshredder spin column sitting on a 2ml eppendorf and centrifuged for 2 minutes at maximum speed (14000 x g). The flow through was transferred to another tube and an equal volume of 70% ethanol was added and mixed by pipetting several times. 700l of the samples was added to a RNeasy spin column and centrifuged for 15 secs for 14000 x g. The flow through was discarded and 700 l of buffer RW1 (supplied) was added to the spin columns and centrifuged for 15 secs at 14000 x g. The flow through was discarded and the column was placed on a new collection tube. 500 l of buffer RPE was added to the column and centrifuged for 2 minutes to dry the RNeasy membrane. To further dry the membrane the column was placed on another tube and centrifuged at maximum speed for one minute to completely dry the column and to remove the trace of RPE buffer. The column was then transferred to another collection tube and 30 l of RNAse free water was added. Finally the tube was centrifuged for one minute (14000 x g) and the elute collected. The RNA was stored at -80C freezer (detailed protocol attached in Appendix). Reverse transcription c-DNA synthesis was done by using SuperscriptTM III First-Strand Synthesis System for RT-PCR. According to the manufacturers instruction 2 l (2 g) of previously prepared RNA was added to 1l of 50uM oligo (dT)20, 1l of 10mM dNTP mix in a tube and DEPC-treated water added to make a volume of 10 l. The reaction tube was incubated at 65C for 5 mins and then placed on ice for one min. In another tube 2 l of 10X RT buffer, 4l of 25mM Mgcl2, 2 l of 0.1DTT, 1 l of RNaseOUTTM (40U/ l) and 1 l of SuperScriptTM III RT (200 U/ l) was added. The 10 l mix of the first tube was added to the second tube and incubated for 50 mins at 50C. The reaction was terminated by incubating at 85C for 5mins and then chilled on ice. 1 l of RNase H was added to the tube and incubated for 20 mins at 37C. The total yield of cDNA was 25 l and this was stored at -20C till further use. Polymerase Chain reaction Polymerase chain reaction was carried out on the cDNA synthesized, using GREX-f* primer GAGTACCTCTGGAGGACAGA and GRINTRON-r* primer ATGCCATTCTTAAGAAACAGGA. For each reaction 5 l of 10xPCR buffer II, 3 or 6 l of 25mM MgCl2, 4 l of 10mM dNTP, 1 l of forward and reverse primer at 10 M and 0.25 l of AmpliTaq Gold Enzyme were mixed in a tube. cDNA at 10 ng/l was added to the reaction tube and made upto 50 ul with deionised water. The reaction was run at 94C for 6 min, and then 35 cycles of 94C for 30 secs, 55C for 30 secs, 68C for 30 secs, 72C for 30 secs followed by 72C for 6 mins. Gel Electrophoresis In order to see the purity of the cDNA synthesized (not contaminated with genomic DNA) gel electrophoresis was carried out. 2% Agarose Gel was prepared with TBE and cyber red added as a fluorescent tag. The gel was poured on a gel plate and a comb was inserted and ran for 30mins at 90V. Relative Quantitative PCR In real-time quantification technology the TaqMan MGB probes contain: A reporter dye (6-FAM) linked to the 5 end of the probe. A minor groove binder (MGB) that increases the melting temperature (Tm) without increasing probe length (Afonina et al., 1997; Kutyavin et al., 1997); it also allow the design of shorter probes. A nonfluorescent quencher (NFQ) at the 3 end of the probe 5 Nuclease Assay Process A TaqMan probe contains a reporter dye at the 5 end and a quencher dye at the 3 end of the probe. The DNA polymerase cleaves the TaqMan probe during PCR and separates the reporter dye and quencher dye. This cleavage results in increased fluorescence of the reporter dye (26). Figure 3.TaqMan probes require a pair of PCR primers in addition to a probe with both a reporter and a quencher dye attached. When the probe is cleaved, the reporter dye is released and generates a fluorescent signal (Invitrogen). The reporter dye does not fluoresce if the probe is intact. During PCR, if the target of interest is present, the probe specifically anneals between the forward and reverse primer sites. On the other hand if the probe hybridizes to the target the DNA polymerase cleaves the probes between the reporter and quencher. The fragmented probes then separate from the target of interest and further polymerisation of the strand continues (26). For quantification of the change in expression of mRNA the ABI 7500 was used to perform the thermal cycling, data collection and data analysis. In a MicroAmp 96 well plate (Applied Biosystem) 10 l of final volume of TaqMan mix was placed. The mixture included 5l of TaqMan Gene Expression Assay, 0.5 l of the primer, 0.5 l of GAPDH (endogenous Control) and 4 l of 1:3 diluted samples. Prior to this study Ct value (cycle threshold) with a standard curve (Fig 5) was constructed and the primer and GAPDH concentration were determined by optimisation studies. All the primers were purchased from applied biosystem and are listed in Table 1. Using the ABI 7500 system the PCR was carried out at 50C for 2 min, followed by 95C for 10 mins. Then 40 cycles of 95C for 15 secs and 60C for 60 secs were performed. Mean relative quantification (RQ) was evaluated using the Ct method using GAPDH as endogenous control. Prior to analysis the PCR products were run on a 2% agarose gel to confirm that the templates have amplified along with GAPDH as endogenous control (figure 5). DATA Analysis The data generated from the RT-PCR were analysed using the recommended threshold by Applied Biosystem and then exported in Excel format. For calibration and generation of standard curves several cDNA cell lines were used: cDNA from DU145, LNCaP and C42B. The slope of the standard curve was calculated from the log input of cDNA in ng/l versus the corresponding Ct value. Basic statistical analysis was performed in Excel. Results Cell Culture Dr Prowse used a non adherent technique suspension culture and identified a group of cells within the prostate cell lines 22RV1, DU145, PC3, VCaP, LNCaP and C42B that had the ability to form prostasphere (Figure 4a). Furthermore using the clonal growth assay, each prostasphere was able to grow a further 1-3 prostaspheres (5b) when dissociated to single cells (10). These prostasphere along with prostate cell lines were used in this study. Immunoflourescence conducted by Dr Prowse on the prostate cancer spheres derived from single cells are illustrated in Figure 4A. Figure 4. Representation of prostasphere formation, culture and the effect of Wnt3a on Keratin 18, CD44 and ABCG2. A) Prostasphere shows self renewal and proliferation and this is a schematic representation of this process. B) Prostasphere formation with 0.1% DU145, 8% LNCaP and 8% of C42B cell lines. C) Effect of Wnt3a on keratin 18, CD44 and ABCG2 (Bisson and Prowse et al 2009). RNA extraction and RTPCR Upon RNA extraction of the cells lines and prostospheres the concentrations were measured by spectrophotometer. It was 234ng/l for C42B and 190ng/l for DU145 respectively. A PCR was conducted with glucocorticoid receptor gene intron primers and gel electrophoresis was carried out to verify the purity of the samples. Only genomic cDNA of LNCaP and Hela cells amplified under 3 mMMg++ conditions (Figure 5). Figure 5. A) Results of quantitative RT-PCR analysis. The PCR in Lanes 1-5 contained 1.5mM Mg++ and lanes 6-10 contained 3mM Mg++. (B) A 2% gel was run with the PCR products that were amplified in Real Time PCR. Lane 1 represented BMI-1, lane 2 NSE, lane 3 ABCG2, lane 4 Nestin, lane 5 K18, lane 6 CD44, lane 7 OCT4, lane 8 PSA, lane and lane 9 sca-1.In all the lanes except lane 8 a double band was observed. The two bands represented GAPDH and the gene of interest. For construction of a standard curve, serial dilutions (1ng/ l, 5ng/l, 20ng/ l and 50ng/ l) of cDNA were used. In all cases, there was a strong linear correlation between the number of thermal cycles required to generate a significant fluorescent signal above background and the log of the input cDNA amount (correlation coefficient 0.90) (Figure 6). The Ct value was against the log of the initial template amount and subjected to linear regression analysis. Figure 6. Real time RT-PCR: standard curves for cDNA obtained from LNCaP, C42B and DU145 cell lines at 1ng/l, 5 l, 20 l and 50 l . A strong linear correlation between the CT values and the log of the input cDNA amount (correlation coefficients ranging from 0.97 to 1.0) were obtained. Quantification and Comparison of the Real Time Quantitative RTPCR results between Adherent cells untreated Prostasphere and treated Prostasphere. Delta Ct values for adherent cells and their correlation with those for prostasphere treated and untreated samples showed high correlation (r 2 90) emerged for all of the tested genes ( Figure 6). GAPDH was used as endogenous control. In order to quantify the gene expression of the prostasphere and treated prostasphere (wnt3a and cyclopamine) to adherent cells (C42B and LNCaP), 10 markers were compared by Q-PCR using GAPDH as endogenous control (Fig 8). The PCR products were resolved on a 2% gel to confirm the templates have amplified along with GAPDH as endogenous control (Figure 5). Duplex product was seen in most of the lanes. The method of calculation was by Ct method. This method calculates the fold change in respect to the normalized gene. In our study we have compared the fold changes of gene expression of the treated and non treated prostosphere relative to the cell line (C42B and LNCaP). In the table (Table 2) we calculated delta delta Ct in relation to the cell line. Each of the samples were run in triplicates, therefore an average of those three were taken in each cases. For example for C42B spheres, the Ct values are 30.19, 29.92, and 30.27. The average of this was taken (30.19, 29.92, 30.27)/3 which is 30.13 and the same was calculated for GAPDH which is 18.94. In each case that is sphere, C42B wnt3a treated, C42B control (dissolved in DMSO) and spheres treated with cyclopamine the average Ct was calculated. Table 2. Example of calculation for quantification of gene expression in fold changes. Sample Average Ct a of samples b Average Ct of GAPDH Ct Ct RQ Values d Prostasphere 30.13 18.94 11.19 -2.01 4.04 Prostasphere +Wnt3a 31.20 19.75 11.46 -1.74 3.34 Prostasphere control 33.97 22.7 11.27 -1.93 3.82 Prostasphere+ cyclopamine 30.28 19.43 10.9 -2.35 5.09 Adherent Cells c 13.20 0 1 a.Cycle threshold. b.Prostasphere, Prostasphere+wnt3a, Prostasphere control, Prostasphere +cyclopamine. c. For adherent cells the Ct value was calculated from the standard curve. d. Relative quantification or fold changes. Ct was calculated by subtracting the Ct of the endogenous control (GAPDH) from the Cts of the gene of interest eg 30.31-18.94=11.19. Fold changes are calculated relative to the adherent cells. Therefore Ct is calculated by subtracting the Ct value of the adherent cells from the Ct of the sample i.e.11.19-13.20=-2.01. Relative quantification (RQ) value of gene expression was calculated by the use of the equation RQ= 2-Ct RQ=2-(-2.01) Therefore an RQ or fold change relative to the adherent cells is 4.04. Figure 7. Q-PCR analysis of the mRNA levels of Nestin, Sca-1, Oct4, BMI-1, NSE, K18, PSA, CD44, ABCG2 and c-kit. Expressions of the markers were calculated by employing the Ct method. (A) Nestin expression was decreased in prostaspheres in C42B adherent cell, prostasphere treated and untreated and were insignificant. (B). Effect of Sca-1 on C42B was unchanged between adherent cells and the prostaspheres. However in LNCaP a modest increase was observed. (C) The prostasphere expressed nearly two fold increase in expression. (D) Oct4 expressed about four fold increase in prostasphere treated samples (Wnt3a and cyclopamine). (E) In LNCaP Oct4 expression is reduced in Wnt 3a treated prostasphere. (F) In C42B prostasphere and Wnt3a treated prostasphere BMI-1 showed slight increase in level of expression. (G) However this change is not as pronounced in LNCaP. (H) NSE marker shows very high expression for C42B prostosphere control and marked reduction when treated with cyclopamine. (I) In LNCaP, no such change was observed between Prostasphere and Wnt3a treated prostasphere. (J and K) Keratin 18 shows extremely high levels in prostasphere with reduction when treated with Wnt3a or cyclopamine. (L and M) PSA failed to show significant changes in the level of expression. Although wnt3a and cyclopamine treated samples showed slight reduction. (N and O) CD44 was not expressed in both C42B and LNCaP prostosphere. However the adherent cells had high expression of the marker. (P) ABCG2 shows high expression of prostasphere in C42B. Wnt3a treated spheres showed reduced levels. (Q) In case of LNCaP extreme level of expression of ABCG2 was observed in prostosphere. (R) c-kit/CD117 was expressed more in the prostasphere with reduced expression on the Wnt3a treated and cyclopamine treated samples. Nestin and CD44 showed significant reduction in expression compared to the adherent cells of C42B. Nestin expressed less than 1% in prostasphere (figure 8A,) and negligible expression of CD44 (figure 7N) in C42B. There is increase in expression of SCA-1, OCT4, BMI-1, K18, ABCG2 and C-KIT (Figure 7 B, C, F, J, K, p, Q and R). NSE showed significant increase (Figure 7 H) in prostasphere control (97% more expression than adherent cells) and 100% increase in expression of K18 prostasphere(Figure J and K) and 100% increase expression of ABCG2 in prostasphere, prostasphere treated with cyclopamine treated and control. Interestingly Wnt3a treated prostasphere showed reduced expression of ABCG2 (Figure 7 P and Q). In LNCaP expression of CD44 is insignificant (0.01%) and PSA expression is reduced by 40% (Figure O and M). In case of LNCaP there was 18% increase in expression of SCA-1, 16% of BMI-1, 50% in NSE, 100% in case of Keratin 18 (Figure 7 C, G, I, and K). A summary of the results are shown in table 3. Table 3. Comparison of fold changes in mRNA expression in 10 selected genes determined by real-time quantitative polymerase chain reaction (RT-qPCR). Discussion Collins et al 2005 (41) in their paper states tumour cells are organised as hierarchy that are responsible for the formation of cancer. They have been able to identify and characterise cancer cell population from prostate tumours that have the ability of cell renewal and regenerate expressing differentiated cell products. Various studies have developed non-adherent sphere culture to characterise cancer cells with stem cell like characteristics. In vitro culture in unattached conditions where cells grow in round balls called spheres is routinely used for enrichment and propagation of stem cells (40). Prostate cancer is a heterogenous disease and to study the prostate cancer cells with stem cell characteristics prostasphere were cultured by Dr Prowse. Previous papers have established stem cell markers namely CD44+, CD133, ABCG2, 21 integrin, Sca-1 and -catenin and PSA can be utilized to identify stem cell population in normal prostate (29,30).However the role of CD117 is yet to be defined in human. Figure 8. The self renewal capacity of cells with stem cell characteristics and the proliferation/differentiation of transit amplifying cells are regulated by WNT signalling. In addition AR activity is the driving force behind proliferation and differentiation of the transit amplifying cell. -catenin which is also an effector of WNT signaling can interact with the activity of AR (Bisson and Prowse et al 2009). In the paper by Bisson and Prowse (10), the authors provide evidence that in absence of AR, WNT activity can control the cell renewal capacity of the prostate cancer cells with stem cell characteristics. On basis of their conclusion they suggested a model (figure 2) where the balance of WNT and AR activity not only regulates the self renewal of prostate cancer cells with stem cell characteristics but also the proliferation and or differentiation of the transit amplifying cells. In my study I tried to characterise the stem cell population within the prostate using different stem cell and differentiation markers and measuring their relative gene expression. This evidence can be used to further charaterise tumour stem cells: as they may comprise only a fraction of the cells responsible for the tumour, and have the abilities of self renewal, proliferation and differentiation. Nestin a neuronal marker, is an intermediate filament protein that identifies progenitor cells in adult tissues. Previous papers (31) have provided evidence of detectable levels of Nestin mRNA and these levels were increased in case androgen-insensitive prostate cancer cell lines (DU145). They were undetectable in the androgen dependent cell line LNCaP. While in C42B, Nestin was expressed only in the adherent cells (Fig 8a). Embryonic stem cell marker such as Sca-1 are used to enrich properties such as, replication quiescence, androgen independence, multilineage differentiation and is capable of promoting regenerative capacity of prostate; in short characteristics of stem cells. In consistent with recent reports (32) our study indicated LNCaP cells grown in anchorage independent conditions showed increase in expression of Sca-1 (Figure 8c). Similarly Oct-4 responsible for stem cell self-renewal (33, 34) showed increase expression in C42B prostasphere (figure 8d). NSE is one of the prognostic indicators of aggressive androgen-independent prostate disease. Neuroendocrine cells provide growth and survival signals to surrounding tumour cells and thereby results in an increase in stem cell population (35, 38, 39). Gene expression is significantly increased in LNCaP prostasphere (Figue 8i). This maybe due to acquisition of the neuroendocrine characteristics by LNCaP in response to long-term androgen ablation therapy (35) or the selective differentiation of prostate cancer stem cells into neuroendcrine cells by non-adherent culture. A recent paper (10) investigated the role of WNT on the size and the self renewal capacity of the prostasphere. The authors noted a significant increase of keratin 18 and CD44 expression with the addition of Wnt3a. This increase in expression was detected in adherent and non adherent cultures with LNCaP prostasphere exhibiting slightly higher level than C42B. CD44 is an important marker with a distinct role in migration and signalling and is present in both stem and differentiating cell population. Evidences have been provided that show CD44 to be present in tumourinitiating cells (36, 37). Therefore it is probable the CD44 would exhibit high expression in the prostasphere and this has been reported in published papers. However in my analysis, (Fig 8N and Fig 8O) shows absences of CD44 expression in both LNCaP and C42B prostasphere although it was possible to construct the standard curve for CD44 with DU145 (figure 8i). Previous studies have provided evidence of reduced expression of CD44 in LNCaP and C42B cell lines. This is probably been reflected in this study. Immunoflourescence done by Dr Prowse (Figure.4C i-vi) described the effect of Wnt3a on keratin 18, CD44 and ABCG2. Their findings were increase of expression of CD44 on Wnt3a treated spheres. Keratin 18 is present in most adenocarcinomas. Levels of K18 increases dramatically in prostosphere but interestingly it is more so when treated with Wnt3a (Figure 8 J). Immunflourescence (Figure 4 I, ii) of K18 shows similar effects (10). This might suggest WNT signalling may promote cell renewal and differentiation (42, 43). Similarly in case of ABCG2 Dr Prowse provided data of immunoflourescence that showed increase in 40% of LNCaP spheres, and 100% in C4-2B spheres. ABCG2 is a haematopoietic marker expressed in variety of stem cells (44). My study shows similar results. Another promising marker c-kit/CD117 has not been fully explored. In murine prostate studies have showed CD117 maybe responsible for self renewal and is capable of regeneration of functional and secretion producing prostate when transplanted in vivo (14). My analysis shows increase in expression in prostasphere with reduced expression in treated samples. This finding seems to be promising although further studies are required. BMI-1 is responsible for proliferation and self renewal capacity and PSA promotes differentiation. Studies have provided evidence of increased expression of BMI-1 and PSA in stem cells. However mRNA expression of these two markers failed to show significant changes. Characterisation and identification of stem cells are very challenging. For proper characterisation specific markers are needed to be identified. In both cell lines C42B and LNCaP Keratin 18 shows the most fold change in expression. Intermediate cells have limited capacity of proliferation and they can differentiate into luminal cells and neuroendocrine cells. Neuroendocrine cells are non proliferative. However the luminal cells have the proliferation capacity. Keratin 18 is a luminal marker and its high expression suggests the luminal cells can proliferate into cells with stem like characteristics. Another interesting marker ABCG2 shows positive fold change. Studies (46) have provided evidence of a subpopulation of ABCG2+/AR-cells that are capable of isolating cancer stem cells by efflux of androgens. ABCG2 is a haemopoietic marker and is responsible for survival of cells. Furthermore Patrawala et al 2005 provides that ABCG2- cells are capable of generating ABCG2+ cells in large clones. Increase of expression of ABCG2 in the QPCR analysis may suggest in hypoxic conditions cells are able to survive and are rapid progenitors (45). My quantitative analysis of the ten markers provides preliminary data of the heterogenecity of prostate cancer cells with stem like characteristics. However it should be kept in mind that the profile of markers may change according to the site of origin and maturity of the stem cells. Overall my datas are very promising but they are at the preliminary stage. In my study I did not replicate the experiments three times which is very much required for validation. Furthermore I have looked in two cell lines and experiments should be conducted for the other cell lines as well. The other things to consider are the shortcomings of the Q-PCR method. A number of variabilities such as RNA degradation, data analysis can change the result. Future direction of work would be addressing the above limitations and exploration of its potential in diagnostic settings. References: Cancer Research UK. 2. Charles Huggins S. Endocrine-induced regression of cancers Nobel Lecture, December 13, 1966. 3. Petrylak DP, Tangen CM, Hussain MH, Lara PN Jr., Jones JA, Taplin ME, Burch PA, Berry D, Moinpour C, Kohli M, Benson MC, Small EJ, Raghavan D, Crawford ED: Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. N Engl J Med 2004, 351 (15):1513-1520. 4. Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310: 644648. 5. The cancer stem cell hypothesis: in search of definitions,markers, and relevance Michail Shipitsin and Kornelia Polyak Laboratory Investigation (2008) 88, 459463). 6. Breast cancer stem cells: implications for therapy of breast cancer. Morrison BJ, Schmidt CW, Lakhani SR, Reynolds BA, Lopez JA. Breast Cancer Res. 2008;10(4):210. 7. Abate-Shen, and Shen, M.M. 2000. Molecular genetics of prostate cancer. Genes Dev. 14:24102434) 8. What is apoptosis, and why is it important? Renehan AG, Booth C, Potten CS. BMJ. 2001 Jun 23;322(7301):1536-8 9. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10(12):901-9. 10. WNT signaling regulates self renewal and differentiation of prostate cancer cells with stem cell characteristics. Isabelle Bisson, David M Prowse. Cell Research (2009) :1-15. 11. De Marzo MA, Nelson WG, Meeker AK, Coffey DS: Stem cell features of benign and malignant prostate epithelial cells. J Urol 1998. 12. Matthew Bui and Robert E. Reiter Cancer and Metastasis Reviews 17: 391399, 1999). 13.Xin L, Lukacs RU, Lawson DA, Cheng D, Witte ON. Selfrenewal and multilineage differentiation in vitro from murine prostate stem cells. Stem Cells 2007; 25:2760-2769. 14. Leong KG, Wang BE, Johnson L, Gao WQ. Generation of a prostate from a single adult stem cell. Nature 2008; 456:804- 808). 15.Hudson DL, OHare M, Watt FM, Masters JR. Proliferative heterogeneity in the human prostate: evidence for epithelial stem cells. Lab Invest 2000; 80:1243-1250. 16. Hudson DL, Guy AT, Fry P, et al. Epithelial cell differentiation pathways in the human prostate: identification of intermediate phenotypes by keratin expression. J Histochem Cytochem 2001; 49:271-278. 17. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on alpha(2)beta(1)-integrin expression. J Cell Sci 2001; 114:3865-3872. 18. Litvinov IV, Vander Griend DJ, Xu Y, et al. Low-calcium serum-free defined medium selects for growth of normal prostatic epithelial stem cells. Cancer Res 2006; 66:8598-8607. 19. Response of glandular versus basal rat ventral prostatic epithelial cells to androgen withdrawal and replacement. English HF, Santen RJ, Isaacs JT. Prostate. 1987;11(3):229-42. 20. Highly purified CD44+ prostate cancer cells from xenograft human tumors are enriched in tumorigenic and metastatic progenitor cells. Patrawala L, Calhoun T, Schneider-Broussard R, Li H, Bhatia B, Tang S, Reilly JG, Chandra D, Zhou J, Claypool K, Coghlan L, Tang DG. Oncogene. 2006 Mar 16;25(12):1696-708. 21.Collins AT, Berry PA, Hyde C, et al. Prospective identification of tumorigenic prostate cancer stem cells. Cancer Res 2005; 65:10946-10951. 22. van Bokhoven A, Varella-Garcia M, Korch C, et al. Molecular characterization of human prostate carcinoma cell lines. Prostate 2003; 57:205-225 23. A distinct side population of cells with high drug efflux capacity in human tumor cells. Hirschmann-Jax C, Foster AE, Wulf GG, Nuchtern JG, Jax TW, Gobel U, Goodell MA, Brenner MK. Proc Natl Acad Sci U S A. 2004 Sep 28;101(39):14228-33. 24. Partial contribution of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)/TRAIL receptor pathway to antitumor effects of interferon-alpha/5-fluorouracil against Hepatocellular Carcinoma. Yamamoto T, Nagano H, Sakon M, Wada H, Eguchi H, Kondo M, Damdinsuren B, Ota H, Nakamura M, Wada H, Marubashi S, Miyamoto A, Dono K, Umeshita K, Nakamori S, Yagita H, Monden M. Clin Cancer Res. 2004 Dec 1;10(23):7884-95. 25. Stromal cell-derived factor-1 (SDF-1) signalling regulates human placental trophoblast cell survival. Jaleel MA, Tsai AC, Sarkar S, Freedman PV, Rubin LP. Mol Hum Reprod. 2004 Dec;10 (12):901-9. 26. Applied biosystem. 27. Identification, Characterization, and Differentiation of Human Prostate Cells.Parmender P. Mehta, Carlos Perez-Stable, Bernard A. Roos, Mehrdad Nadji Methods in Molecular Biology.Vol:137Jan-21-200: 317-335 28. Unopposed c-MYC expression in benign prostatic epithelium causes a cancer phenotype. Williams K, Fernandez S, Stien X, Ishii K, Love HD, Lau YF, Roberts RL, Hayward SW. Prostate. 2005 Jun 1;63(4):369-84. 29. Collins AT, Habib FK, Maitland NJ, Neal DE. Identification and isolation of human prostate epithelial stem cells based on a2h1-integrin expression. J Cell Sci 2001;114:386572. 30. Richardson GD, Robson CN, Lang SH, Neal DE, Maitland NJ, Collins AT. CD133, a novel marker for human prostatic epithelial stem cells. J Cell Sci 2004;117: 353945. 31.Kleeberger, Wolfram, Bova, G. Steven, Nielsen, Matthew E., Herawi, Mehsati, Chuang, Ai-Ying, Epstein, Jonathan I., Berman, David M. Roles for the Stem Cell Associated Intermediate Filament Nestin in Prostate Cancer Migration and Metastasis Cancer Res 2007 67: 9199-9206. 32. Anchorage-independent culture maintains prostate stem cells. Shi X, Gipp J, Bushman W. Dev Biol. 2007 Dec 1;312(1):396-406. Epub 2007 Sep 29). 33. Oct-4: gatekeeper in the beginnings of mammalian development. Pesce M, Schler HR.Stem Cells. 2001;19(4):271-8. 34. Glycoconjugate expression during embryogenesis and its biological significance. Bruce A. Fenderson, E. M. Eddy, Sen-Itiroh Hakomori.BioEssays Volume12, Issue4, Date:April 1990, Pages:173-179 35. Bonkhoff, H, Remgerger, K (1996). Differentiation pathways and histogenetic aspects of normal and abnormal prostatic growth: a stem cell model. Prostate 28:98-106. 36. Patrawala L, Calhoun-Davis T, Schneider-Broussard R, Tang DG. Hierarchical organization of prostate cancer cells in xenograft tumors: the CD44+alpha2beta1+ cell population is enriched in tumor-initiating cells. Cancer Res 2007; 67:6796- 6805. 37. Hurt EM, Kawasaki BT, Klarmann GJ, Thomas SB, Farrar WL. CD44+ CD24(-) prostate cells are early cancer progenitor/ stem cells that provide a model for patients with poor prognosis. Br J Cancer 2008; 98:756-765. 38. Shen R, Dorai T, Szaboles M, Katz AE, Olsson CA, Buttyan R. Transdifferentiation of cultured human prostate cells to a neuroendocrine cell phenotype in a hormone-depleted medium. Urol Res 1997;3:6775. 39. Farini D, Puglianiello A, Mammi C, Siracusa G, Moretti C. Dual effect of pituitary adenylate cyclase activating polypeptide on prostate tumor LNCaP cells: short- and long-term exposure affect proliferation and neuroendocrine differentiation. Endocrinology 2003;144: 163143. 40. Jensen JB, Parmar M. Strengths and limitations of the neurosphere culture system. Mol Neurobiol 2006;34:153161. 41. Collins, Anne T., Berry, Paul A., Hyde, Catherine, Stower, Michael J., Maitland, Norman Prospective Identification of Tumorigenic Prostate Cancer Stem Cells Cancer Res 2005 65: 10946-10951. 42.Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006; 127:469-480. moment. J Pathol 2008; 214:3-9. 43.Lo Celso C, Prowse DM, Watt FM. Transient activation of beta-catenin signalling in adult mouse epidermis is sufficient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours. Development 2004; 131:1787-1799. 44. Sheng Zhou, John D. Schuetz, Kevin D. Bunting, Anne-Marie Colapietro, Janardhan Sampath, John J. Morris, Irina Lagutina, Gerard C. Grosveld, Mitsujiro Osawa, Hiromitsu Nakauchi Brian P. Sorrentino . The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype, Nature Medicine 7, 1028 1034 (2001). 45. L. Patrawala, T. Calhoun and R. Schneider-Broussard et al., Side population is enriched in tumorigenic, stem-like cancer cells, whereas ABCG2+ and ABCG2 cancer cells are similarly tumorigenic, Cancer Res 65 (2005), pp. 62076219. 46. W.J. Huss, D.R. Gray and N.M. Greenberg et al., Breast cancer resistance protein-mediated efflux of androgen in putative benign and malignant prostate stem cells, Cancer Res 65 (2005), pp. 66406650. Appendix Protocols and Supporting documents Protocol: Purification of Total RNA from Animal Cells This protocol requires the RNeasy Mini Kit. Determining the correct amount of starting material It is essential to use the correct amount of starting material in order to obtain optimal RNA yield and purity. The minimum amount is generally 100 cells, while the maximum amount depends on: The RNA content of the cell type The RNA binding capacity of the RNeasy spin column (100 g RNA) The volume of Buffer RLT required for efficient lysis (the maximum volume of Buffer RLT that can be used limits the maximum amount of starting material to 1 x 107 cells) RNA content can vary greatly between cell types. The following examples illustrate how to determine the maximum amount of starting material: COS cells have high RNA content (approximately 35 g RNA per 106 cells). Do not use more than 3 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. HeLa cells have average RNA content (approximately 15 g RNA per 106 cells). Do not use more than 7 x 106 cells, otherwise the RNA binding capacity of the RNeasy spin column will be exceeded. NIH/3T3 cells have low RNA content (approximately 10 g RNA per 106 cells). The maximum amount of starting material (1 x 107 cells) can be used. If processing a cell type not listed and if there is no information about its RNA content, we recommend starting with no more than 34 x 106 cells. Depending on RNA yield and purity, it may be possible to increase the cell number in subsequent preparations. Do not overload the RNeasy spin column, as this will significantly reduce RNA yield and purity. Counting cells is the most accurate way to quantitate the amount of starting material. As a guide, the number of HeLa cells obtained in various culture vessels after confluent growth is given in Table 5 SuperScriptTM III First Stand Synthesis System for RT-PCR Amplification of Target cDNA The first-strand cDNA obtained in the synthesis reaction may be amplified directly using PCR. We recommend using 10% of the first-strand reaction (2 l) for PCR. However, for some targets, increasing the amount of firststrand reaction up to 10 l in PCR may result in increased product yield. We recommend the following DNA polymerases (for ordering information, : Platinum Taq DNA Polymerase provides automatic hot-start conditions for increased specificity and sensitivity. It is recommended for targets up to 4 kb. Platinum Taq DNA Polymerase High Fidelity provides increased fidelity and higher yields for targets up to 15 kb. Platinum Pfx DNA Polymerase possesses a proofreading 3 to 5exonuclease activity and provides maximum fidelity for PCR. It is recommended for targets up to 12 kb. Protocol for DNA Amplification A Master mix of reagents (water, dNTPs, Primers and Enzymes) for all samples can be prepared fast and then aliquoted to individual tubes. Magnesium chloride and the template DNA are then added. Using such mixes would reduce pipetting loss, increase accuracy and reduce the number of transfers. Perform Amplification in Applied Biosystem PCR tube. DNA may stick to the plastic and since the nuclease are found on the surfaces sterile siliconized tubes and tips are used.